Displaying DV493948 on SAM Chip 1.0 (GPL2557): SAM vs Whole Seedling

Accession 1: DV493948 (GenBank)  Gene: 0
Accession 2:   Library Index: IUG38_RS-H-11
Gene Names:
  • MySEG 123
  • contains SDRv3.1_13447
Categories:   
 ATPase
 Cell Division
 Cell Cycle
 DNA Replication
 Chromatin
 Chromatin Remodeling
 Chromatin Structure
 Cytoskeletal
 DNA Repair
 Defense
 Development
 Extracellular Matrix/Cell Wall
 Gene Silencing
  Metabolism
 Lipid
 Nucleotide
 Amino Acid
 Sugar
 Energy
 MySEG
 No hits
 Other
 Photosynthesis-related
 Protein Fate
 Proteolysis
 Chaperone
 RNA Binding Protein
 RNA Processing
 Respiration
  Signal Transduction
 Phosphatase
 G-proteins and Associated Proteins
 Signal Molecules
 Kinases
 Receptors
 Stress-related
 Transcription
 Transcription-Associated Proteins
 Transcription Factors
 Translation
 Ribosome
 Translation-Associated Proteins
 Transport
 Transposable Elements
 DNA Transposons
 Retrotransposon
 Unknown
 Vesicle Trafficking
GO Categories:
Molecular Function
molecular_function unknown
signal transducer activity
transporter activity
antioxidant activity
catalytic activity
triplet codon-amino acid adaptor activity
enzyme regulator activity
transcription regulator activity
binding
motor activity
structural molecule activity
nutrient reservoir activity
chaperone regulator activity
 Biological Process
behavior
physiological process
cellular process
biological_process unknown
regulation of biological process
development
viral life cycle
 Cell Component
cellular_component unknown
extracellular region
virion
cell
organelle
extracellular matrix
protein complex
Light Intensity Reads P-Value Fold Change
Low 2.26e-06 2263.66
Medium 7.25e-05 114.76
High 2.12e-06 76.7642
BLAST results for DV493948   
BLASTN E-value: 6e-139 Longest MEC sequence 
BLASTX E-value: None    
MAGI blast Fresh results
Show/Hide Reading Frames/PsortPrediction
Researcher: Ashley Lough (djb checked), (eneda rechecked)/ Kate Browning   Last Updated: 2007-05-14
Notes:

Replaces accession AI820196

no significant hits

could not identify a longer sequence on MAGI database

BlastX with MAGI_105361 still produced not significant hits

Ran interproscan on this accession's sequence. Results: no hits

Sequence was ran through repeat masker and it showed 

>DV493948 1000119-H06.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence.  (333 bp masked -- 63.19% masked)
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTCATTCCCAACATATATCAAGTANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTTCCTCCTTTCCTCCTTCCTTCCTCCCACCAATTCTC
CAATCGGAACTTGCACCCACACGAAGAAGATCCGGCGAGGAAGGACATCACTTGGAGAGGAGGAGATGGGAGGGGGGTGG
CGGCTAGGGTTGAGGGAATGGGGGCTGCTGCACAAGAGCTCGTGCCG
 
Blast Repeats showed best hits with SDRs
zm_SDRv3.1_13447                                                       98   1e-20 
zm_SDRv3.1_9004                                                        90   3e-18 


MicroRNA database results: no hits


There is no MAGI (4.0) for this sequence that is within an acceptable e vaule


Blast of BAC sequences on MAGI shows that the sequence hits two times on one BAC and once on another 


suggesting that the sequence at least has a paralog and may very well be a repeated element


Electronic Northern (NCBI Blastn of maize EST's): shows expression in BMS tissue, and Endosperm
*there is no evidence of alternative splicing

NSF Logo

Partial support for this work is provided by the National Science Foundation.

Truman State University | Math & CS Department | Biology Department