Replaces accession AW017559

Many blastx hits with copipa gag-pol polyproteins

gi|33113977|gb|AAP94599.1|  putative copia-type pol polyprotein [   255    7e-67
gi|18254412|gb|AAL66753.1|  putative copia-type pol polyprotein [   255    7e-67
gi|23928449|gb|AAN40035.1|  putative gag-pol polyprotein [Zea may   252    6e-66
gi|33113960|gb|AAP94582.1|  putative copia-type polyprotein [Zea    251    1e-65
gi|23928439|gb|AAN40025.1|  putative gag-pol polyprotein [Zea may   243    3e-63
gi|18568272|gb|AAL76004.1|  putative gag-pol polyprotein [Zea may   239    7e-62
gi|4416301|gb|AAD20306.1|  gag protein [Zea mays]                   236    4e-61

BlastN supports blastx results:

>gi|46200524|gb|AF466202.2| Zea mays putative pol protein gene, partial cds; and putative 
gag-pol precursor -orf2, putative Fourf gag/pol protein, putative 
NADP-dependent malic enzyme, putative argonaute protein, 
putative pinhead protein, putative pol protein, putative 
gag protein, putative TNP2, r1-B73 proteins, putative genetic 
modifier, putative S-receptor kinase, putative aldose reductase-related 
protein, putative glutathione peroxidase, putative 
glycerol 3-phosphate permease, putative response regulator, 
and putative 4-coumarate-CoA ligase-like protein genes, 
complete cds
Length=290350

 Features flanking this part of subject sequence:
   77450 bp at 5' side: putative aldose reductase-related protein
   29001 bp at 3' side: putative glutathione peroxidase

 Score = 1114 bits (562),  Expect = 0.0
 Identities = 598/610 (98%), Gaps = 0/610 (0%)
 Strand=Plus/Plus
Repeatmasker showed :

Repeats

Many hits with Ji retrotransposons when sequence was used as a query of the repeat database at MAGI.

>ZRSiTERTOOT0203 ji_123C01-1 ji_276N13_5 Contig25 bases 55417. .64927
||retrotransposon
Length = 9511
Score = 1106 bits (558), Expect = 0.0
Identities = 597/610 (97%)
Strand = Plus / Plus
Query: 1    aacggaggagaagaaggaggaggctacaccaagtcgacaaccaatcgacgcctccaagct 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2404 aacggaggagaagaaggaggaggctacaccaagtcgacaaccaatcgacgcctccaagct 2463
Query: 61   cgacaatgaggaaatggcgctcgtcatcaagagtttccgccaaatcctcaaacaaaggag 120
||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 2464 cgacaatgaggaaatggcgctcgtcatcaagagcttccgtcaaatcctcaaacaaaggag 2523
Query: 121  ggggaaagactacaagtcccgctccaagaaggtttgctacaagtgtggtaagcccggtca 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2524 ggggaaagactacaagtcccgctccaagaaggtttgctacaagtgtggtaagcccggtca 2583
Query: 181  ttttattgctaaatgtcctatatctagtgacagtgaccgaggtgacgacaagaaggggag 240
|| |||||||||||||||||| |||||||||||||||||||| |||||||||||||||||
Sbjct: 2584 ttatattgctaaatgtcctatgtctagtgacagtgaccgaggcgacgacaagaaggggag 2643
Query: 241  acgaaaggaaaagaagaggtattacaagaagaagggcggcgatgcccatgtttgtcgcga 300
| ||||||| ||||| ||||| ||||||||||||||||||||||| ||||||||||| ||
Sbjct: 2644 aagaaaggagaagaaaaggtactacaagaagaagggcggcgatgctcatgtttgtcggga 2703
Query: 301  atgggactccgacgagagctcaagcgactcctccgacgacgaggacgccgccaacatcgc 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2704 atgggactccgacgagagctcaagcgactcctccgacgacgaggacgccgccaacatcgc 2763
Query: 361  cgtcaccaagggactcctcttccccaacgtcggccacaagtgcctcatggcaaaggacgg 420
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 2764 cgtcaccaagggactcctcttccccaatgtcggccacaagtgcctcatggcaaaggacgg 2823
Query: 421  caaaaagaaggttaaatctaaatcctccactaaatatgaatcctctagtgatgacaatgc 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2824 caaaaagaaggttaaatctaaatcctccactaaatatgaatcctctagtgatgacaatgc 2883
Query: 481  tagtgatgaggaagataatttgcgttccctttttgccaaccttaacatagctcaaaaaga 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2884 tagtgatgaggaagataatttgcgttccctttttgccaaccttaacatagctcaaaaaga 2943
Query: 541  aaaattgaatgaattggttagtgctattcatgaaaacgacgaccttttggattcccaaga 600
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 2944 aaaattgaatgaattggttagtgctattcatgaaaaggacgaccttttggattcccaaga 3003
Query: 601  ggattgtcta 610
||||||||||
Sbjct: 3004 ggattgtcta 3013

Interpro scan showed no significant hits.

Literature:

1: Genome Res. 2004 Oct;14(10A):1924-31.

Related Articles, Links

 
Gene loss and movement in the maize genome.

Lai J, Ma J, Swigonova Z, Ramakrishna W, Linton E, Llaca V, Tanyolac B, Park YJ, Jeong OY, Bennetzen JL, Messing J.

Waksman Institute of Microbiology, Rutgers University, Piscataway, New Jersey 08854-8020, USA.

Maize(Zea mays L. ssp. mays), one of the most important agricultural cropsin the world, originated by hybridization of two closely relatedprogenitors. To investigate the fate of its genes aftertetraploidization, we analyzed the sequence of five duplicated regionsfrom different chromosomal locations. We also compared correspondingregions from sorghum and rice, two important crops that have largelycollinear maps with maize. The split of sorghum and maize progenitorswas recently estimated to be 11.9 Mya, whereas rice diverged from thecommon ancestor of maize and sorghum approximately 50 Mya. A data setof roughly 4 Mb yielded 206 predicted genes from the three species,excluding any transposon-related genes, but including eight generemnants. On average, 14% of the genes within the aligned regions arenoncollinear between any two species. However, scoring each maizeregion separately, the set of noncollinear genes between all fourregions jumps to 68%. This is largely because at least 50% of theduplicated genes from the two progenitors of maize have been lost overa very short period of time, possibly as short as 5 million years.Using the nearly completed rice sequence, we found noncollinear genesin other chromosomal positions, frequently in more than one. Thisdemonstrates that many genes in these species have moved to newchromosomal locations in the last 50 million years or less, most assingle gene events that did not dramatically alter gene structure.

PMID: 15466290 [PubMed - indexed for MEDLINE]

1: Proc Natl Acad Sci U S A. 2004 Jan 20;101(3):700-7. Epub 2003 Dec 30.

Related Articles, Links

  
Pattern of diversity in the genomic region near the maize domestication gene tb1.

Clark RM, Linton E, Messing J, Doebley JF.

Laboratory of Genetics, University of Wisconsin, Madison, WI 53706, USA.

Domesticated maize and its wild ancestor (teosinte) differ strikingly in morphology and afford an opportunity to examine the connection between strong selection and diversity in a major crop species. The tb1 gene largely controls the increase in apical dominance in maize relative to teosinte, and a region of the tb1 locus 5' to the transcript sequence was a target of selection during maize domestication. To better characterize the impact of selection at a major "domestication" locus, we have sequenced the upstream tb1 genomic region and systematically sampled nucleotide diversity for sites located as far as 163 kb upstream to tb1. Our analyses define a selective sweep of approximately 60-90 kb 5' to the tb1 transcribed sequence. The selected region harbors a mixture of unique sequences and large repetitive elements, but it contains no predicted genes. Diversity at the nearest 5' gene to tb1 is typical of that for neutral maize loci, indicating that selection at tb1 has had a minimal impact on the surrounding chromosomal region. Our data also show low intergenic linkage disequilibrium in the region and suggest that selection has had a minor role in shaping the pattern of linkage disequilibrium that is observed. Finally, our data raise the possibility that maize-like tb1 haplotypes are present in extant teosinte populations, and our findings also suggest a model of tb1 gene regulation that differs from traditional views of how plant gene expression is controlled.

PMID: 14701910 [PubMed - indexed for MEDLINE]