BLASTn produced the following top hits:
Sequences producing significant alignments: (Click headers to sort columns)
BLASTx produced the following insignificant top hits with the original sequence:
Score E
Sequences producing significant alignments: (Bits) Value
ref|YP_001887652.1| integral membrane protein [Clostridium bo... 36.2 2.3 
ref|YP_001917293.1| cytochrome c assembly protein [Natranaero... 34.3 8.7
ref|NP_220409.1| hypothetical protein RP014 [Rickettsia prowa... 34.3 8.7
BLASTn with the MEC sequence prodcued the following top hits:
Sequences producing significant alignments: (Click headers to sort columns)
BLASTx with the MEC produced the following insignificant top hits:
Sequences producing significant alignments: (Bits) Value
ref|YP_001887652.1| integral membrane protein [Clostridium bo... 36.2 2.3
ref|YP_001917293.1| cytochrome c assembly protein [Natranaero... 34.3 8.8
ref|NP_220409.1| hypothetical protein RP014 [Rickettsia prowa... 34.3 8.8
Replaces accession AI711970
High similarity to DV491774, also annotated as a MySEG.
no significant hits likely 3'UTR. Could not identify a longer sequence on MAGI to perform further analysis.
Interproscan results of the genbank sequence: no hits
Ran sequence through repeatmasker at MAGI database and got the following resutls:
Repeats
>AI711970 614001E12.x1 614 - root cDNA library from Walbot Lab Zea mays cDNA, mRNA sequence. (248 bp masked -- 39.74% masked)
TTTTTTTTTTTTTTTTTTAATTTCAACTTCAAGTTTATGTTACATTTTAAACTTAGGGTAAAATACAGGGTAAAATACAC
CAACGAAAAGATCAACATAAATGCAAATATGTGTATATATATTTGTTTGTATTATTTACTTTATTAATTGATTACGCAAA
TGTTTTCAAATATGAATACCGCACACATATTATTTATTCCAAGAGAACATCATTTTAAATGTATAGACAATTTAAATGTT
TATTCAAAATTTCCATAATTATTACTAATTCATTTTAAGAGATGTTATTTTCAAATTTCTATTGGGAGATACTTTAGTTT
GATTTCTTTTGCTAACCCCAAAATTAGGATTTTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAA
AGTTTTTTATATGGATATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Performed a blastn of repeat database at MAGI:
Score E
Sequences producing significant alignments: (bits) Value
ZRSiTERTOOT0294 prem1_276N13-4 prem1_276N13-4 276N13 bases 39168... 172 4e-43
ZRSiTERTOOT0301 prem1_af391808-1 prem1_af391808-1 af391808 bases... 141 1e-33
ZRSiTERTOOT0299 prem1_573L14-1 prem1_573L14-1 ZM573L14.fasta.scr... 103 3e-22
ZRSiTERTOOT0300 prem1_af090447-2hdnm prem1_af090447-2hdnm af0904... 80 4e-15
ZRSiTERTOOT0291 prem1_276N13-1 prem1_276N13-1 276N13.fasta.scree... 70 4e-12
ZRSiTERTOOT0297 prem1_438D03-1 prem1_Z438D03-1 Z438D03 bases 909... 68 2e-11
ZRSiTERTOOT0288 prem-1_464F01-1 prem-1_Z464F01-1 ZZ464F01 bases ... 68 2e-11
ZRSiTERTOOT0289 prem1_123C01-1 prem1_123C01-1 Contig25 bases 1. ... 50 4e-06
ZRSiTERT0020068 prem1_af090447-1 Victor's gypsy-like element (PR... 48 1e-05
Information on highest hit:
>ZRSiTERTOOT0294 prem1_276N13-4 prem1_276N13-4 276N13 bases 39168.
.31243 ||retrotransposon
Length = 7926
Score = 172 bits (87), Expect = 3e-43
Identities = 108/115 (93%)
Strand = Plus / Minus
Query: 363 aaattctaccccccttaacagaaatctcgtcctcgagatttgtaagaaaagggatataat 422
|||| ||||||||||||| | ||||||||||||||||||||||||||||||||||||||
Sbjct: 4625 aaatcctaccccccttaaaaataatctcgtcctcgagatttgtaagaaaagggatataat 4566
Query: 423 aagtttggtctagaattttagtttctcatttggttttggaaaccaaagttttgtt 477
| ||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 4565 aggtttggtctagaattttagtttctcatttggttttgggaatcaaagttttgtt 4511
Score = 99.6 bits (50), Expect = 4e-21
Identities = 87/98 (88%), Gaps = 5/98 (5%)
Strand = Plus / Minus
Query: 528 aggtacggttatggcaagtataggttgtggcaaggaagagtataataaggaaagacttca 587
|||||||||||||||||||| |||||||||||||| |||||||||||||| ||||||
Sbjct: 4445 aggtacggttatggcaagtagaggttgtggcaagg----gtataataaggaaaaacttca 4390
Query: 588 tctanaact-gggatcttgattccgctggcgattcaac 624
|| |||| |||||||||||||||||||||||||||
Sbjct: 4389 tcctaaactatggatcttgattccgctggcgattcaac 4352
The sequence doesn't hit with a MAGI (4.0)
MAGI assembled BAC database results: no significant hits
NCBI maize genome blast results: no hits
NCBI maize htgs blastn results: no significant hits
MicroRNA database: no hits
Electronic Northern (Blastn of maize EST on NCBI): expressed in root and apex
*no evidence of alternative spicing
Related Literature:
Chromosome Res. 1996 Jan;4(1):15-23.
Links
Molecular analysis of the structure of the maize B-chromosome.
Department of Botany, University of Reading, UK.
The overall composition of the maize B is similar to that of the standard chromosome complement (A-chromosomes). This has been demonstrated by the use of several methods including: (a) genomic in situ hybridization (GISH), (b) analysis of highly repetitive sequences by the comparison of restriction digests of 0B and +B DNA and (c) the characterization of middle-repetitive cloned sequences. By the use of the technique of random amplification of polymorphic DNA-polymerase chain reaction, we have identified a B-specific repetitive sequence family. Sequence analysis of the B-specific clone reveals a relationship to the PREM-1 family of maize retroelements, which are preferentially transcribed in pollen. These results suggest an internal origin of the B-chromosome from within the maize genome, but demonstrate also that specific sequences can evolve by rapid processes of genomic turnover. Models for the origin of the maize B are discussed in the context of the present data.
PMID: 8653263 [PubMed - indexed for MEDLINE]
