Replaces accession AI491680
Many Blastx hits with gag-pol polyproteins. Got "Tekay" from the top hit's genbank entry.
Could not identify a longer sequence on MAGI so ran sequence through interproscan and got the following results:
Repeats
>DV943366 1000132-H02.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence. (408 bp masked -- 57.38% masked)
TTTTTTTTTTTTTTATGTTTTCCTTTTCCTTTTAGTTTTCAAATTCCATTTTAAATTCAGATTTAAATTCAAATCTTGTG
CCAGTTTATCCTCAATTTATATTGTGAAATAAAAAGTACCAATCTTAGAAGTATAATCACATATATGTTGTTTATATTTT
ATACCCTTTATTCCTTTTCTCCATATTTCTAAAGTCCCCTTTAACTCTTAAATTCTCATCTAGGTATTAATGTATTCTCT
TTATTTTATATATTTATATATTTTTTTGTATAGTCACAAAATACACTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNGATGGCATATATTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
No significant hits
very short sequence
BlastX using DNA from MAGI_198400 also picked up no significant hitsany
When the accession's sequence was used as a query in a blastn of the repeat database at MAGI, it had numerous hits with pre elements. THe highest hit follows:
>ZRSiTERTOOT0289 prem1_123C01-1 prem1_123C01-1 Contig25 bases 1. .9689
||retrotransposon
Length = 10397
Score = 458 bits (231), Expect = e-129
Identities = 322/351 (91%), Gaps = 1/351 (0%)
Strand = Plus / Minus
Query: 362 atggtgttcacataggatgatgcataaaggttaaatccacataaggagaaattattt-ct 420
|||||||||||| ||||||||| | |||||||| |||||||||||||||| ||| ||
Sbjct: 7111 atggtgttcacaggtgatgatgcacacaggttaaacccacataaggagaaatcgttttct 7052
Query: 421 ctattggtattatttctagcaaattacaaagtgggtgttacaaatcctaccccccttaaa 480
||||||||||| |||| |||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 7051 ctattggtattctttccagcagattacaaagtgggtgttacaaatcctaccccccttaaa 6992
Query: 481 aataatctcgtcctcgagatttaagaagatctagggaaaaggtggggaaaatctatgcga 540
|| ||||||||||| |||||||| ||||| ||| |||||||||||||||||| ||||||
Sbjct: 6991 aagaatctcgtccttgagatttaggaagaagtagagaaaaggtggggaaaatcgatgcga 6932
Query: 541 agctcttcttctctttcccaagttgcttcattttcaccgtggtgactccattgcactttg 600
||||||||||||||||||||||||||||||| |||||||||||| |||||||| ||||||
Sbjct: 6931 agctcttcttctctttcccaagttgcttcatcttcaccgtggtggctccattgaactttg 6872
Query: 601 cacatctttatcaccttatttcttgtaactcgagtcaaagtatccaaaatcttgatcggg 660
||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 6871 cacatctttatcaccttgtttctcgtaacccgagtcaaagtatccaaaatcttgatcggg 6812
Query: 661 tattccgtgtaagtcaaatcaccttgaacactgagttcttccatgggtaac 711
|| ||||||||||||||||||||||||| |||||| |||||||| ||||||
Sbjct: 6811 tactccgtgtaagtcaaatcaccttgaatactgagctcttccattggtaac 6761
Score = 107 bits (54), Expect = 2e-23
Identities = 91/102 (89%), Gaps = 1/102 (0%)
Strand = Plus / Minus
Query: 362 atggtgttcacataggatgatgcataaaggttaaatccacataaggagaaattattt-ct 420
|||||||||||| ||||||||| | |||||||| |||||||||||||||| ||| ||
Sbjct: 102 atggtgttcacaggtgatgatgcacacaggttaaacccacataaggagaaatcgttttct 43
Query: 421 ctattggtattatttctagcaaattacaaagtgggtgttaca 462
||||||||||| ||||||||| ||||||||||||||||||||
Sbjct: 42 ctattggtattctttctagcagattacaaagtgggtgttaca 1
Score = 38.2 bits (19), Expect = 0.015
Identities = 34/39 (87%)
Strand = Plus / Minus
Query: 277 caaaatacactccacaaacacaatatccagcatgatgca 315
|||||| ||| ||||||| | ||||| ||||||||||||
Sbjct: 7190 caaaatgcacaccacaaataaaatattcagcatgatgca 7152
Score = 38.2 bits (19), Expect = 0.015
Identities = 34/39 (87%)
Strand = Plus / Minus
Query: 277 caaaatacactccacaaacacaatatccagcatgatgca 315
|||||| ||| ||||||| | ||||| ||||||||||||
Sbjct: 181 caaaatgcacaccacaaataaaatattcagcatgatgca 143
Related Literature:
Vaccine. 2007 Mar 1;25(11):1969-92. Epub 2006 Dec 6.
Links
Generation and immunogenicity of novel HIV/AIDS vaccine candidates targeting HIV-1 Env/Gag-Pol-Nef antigens of clade C.
- Gomez CE,
- Najera JL,
- Jimenez V,
- Bieler K,
- Wild J,
- Kostic L,
- Heidari S,
- Chen M,
- Frachette MJ,
- Pantaleo G,
- Wolf H,
- Liljestrom P,
- Wagner R,
- Esteban M.
Department of Molecular and Cellular Biology, Centro Nacional de Biotecnologia, CSIC, Ciudad Universitaria Cantoblanco, 28049 Madrid, Spain.
Recombinants based on the attenuated vaccinia virus strains MVA and NYVAC are considered candidate vectors against different human diseases. In this study we have generated and characterized in BALB/c and in transgenic HHD mice the immunogenicity of two attenuated poxvirus vectors expressing in a single locus (TK) the codon optimized HIV-1 genes encoding gp120 and Gag-Pol-Nef (GPN) polyprotein of clade C (referred as MVA-C and NYVAC-C). In HHD mice primed with either MVA-C or NYVAC-C, or primed with DNA-C and boosted with the poxvirus vectors, the splenic T cell responses against clade C peptides spanning gp120/GPN was broad and mainly directed against Gag-1, Env-1 and Env-2 peptide pools. In BALB/c mice immunized with the homologous or the heterologous combination of poxvirus vectors or with Semliki forest virus (SFV) vectors expressing gp120/GPN, the immune response was also broad but the most immunogenic peptides were Env-1, GPN-1 and GPN-2. Differences in the magnitude of the cellular immune responses were observed between the poxvirus vectors depending on the protocol used. The specific cellular immune response triggered by the poxvirus vectors was Th1 type. The cellular response against the vectors was higher for NYVAC than for MVA in both HHD and BALB/c mice, but differences in viral antigen recognition between the vectors was observed in sera from the poxvirus-immunized animals. These results demonstrate the immunogenic potential of MVA-C and NYVAC-C as novel vaccine candidates against clade C of HIV-1.
PMID: 17224219 [PubMed - in process]
