Very close similarity to DV550925.
which might be alternatively spliced and is not upregulated.

Results of madi chip blast.

>B-3-2-1-17(DV550925) gi|78180597|gb|DV550925.1| 1000051-A11.GAD10-F UGI-Reseq Zea mays
           cDNA
          Length = 480

 Score =  406 bits (205), Expect = e-113
 Identities = 211/213 (99%)
 Strand = Plus / Plus

                                                                       
Query: 17  agagaacataatagacattaataatctgctagcaatggaaagacaaccataacggcatga 76
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 57  agagaacataatagacattaataatctgctagcaatggaaagacaaccataacggcatga 116

                                                                       
Query: 77  actaaatcaaccagtgcgcacaactagttagaaacaacatcttttgacaagaagtttcta 136
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 117 actaaatcaaccagtgcgcacaactagttagaaacaacatcctttgacaagaagtttcta 176

                                                                       
Query: 137 attaaatcatgactgcgcctaagcagcgttattatgagagtgaaggtggatgtgctgcta 196
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 177 attaaatcatgactgcgcctaagcagcgttattatgagagtgaaggtagatgtgctgcta 236

                                            
Query: 197 cttcccacttcccttgatgagcaacaagcacct 229
           |||||||||||||||||||||||||||||||||
Sbjct: 237 cttcccacttcccttgatgagcaacaagcacct 269





 Score =  139 bits (70), Expect = 6e-33
 Identities = 70/70 (100%)
 Strand = Plus / Plus

                                                                       
Query: 225 cacctagggtttccccaagaaattctgcaagaagagatggggaagaacatctccttgatc 284
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 314 cacctagggtttccccaagaaattctgcaagaagagatggggaagaacatctccttgatc 373

                     
Query: 285 ctctcttccc 294
           ||||||||||
Sbjct: 374 ctctcttccc 383
The very close similarity of the sequences and the gap in one and continuity in the other
suggest that this is an example of alternative splicing.

Replaces accession AI745816

no significant Blastx hits
could not identify a longer MEC sequence on the MAGI database, so ran InterProScan on the accessions sequence (445 bp).

No informative hits on InterProScan

Repeat masker:

>DV495075 1000117-H08.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence.  (395 bp masked -- 88.76% masked)
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGC
CAGCCCAATGGAAAAGGAGAGAGGGGCGGCCAAGTGTGGGAGGGG

Repeats blast shows:

zm_SDRv3.1_13534                                                      276   2e-74 
zm_SDRv3.1_13447                                                      212   3e-55 
zm_SDRv3.1_13540                                                      170   1e-42