Replaces accession AI973304
No significant hits. BlastX using DNA from MAGI_60940 also picked up no significant hits
Could not identify a longer maize EST contig
Ran interproscan on this accession's seqeuence:no hits
Sequence was ran through repeat maseker and it showed:
>DV490676 1000043-D01.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence. (272 bp masked -- 36.71% masked)
TTTTTTTTTTTTTTTTATGTTTCTTATTTTCCCATTTCAGTTTTAAATCCCAACTTCAATTTTTATTCTAGGTTTTAGAC
TTTAATAGAATTCACAACAAACAGATAAAATATCCAGTATAATATGCAAGTATTTTTTTTACTAATTATCTTACCTCGTT
ATTTGAAAATTTATTTCAAATATGCAATGCACACATGAAATGTTTATTTTTAAGAAAATATGGTTTTAAGTATTTTAGTT
AAAATTTCATTTAAAAGTGAATATTCATTACTTGATTATTTTAGGGGGAAGTAATGTATTTTTTTTCTATCATGAGTTAC
TTTAACACGTAAAAAAATATTTTATATACAGTCCTAGAAGGGGATAATCCATTCATTATTTCTTGAAATTTACAAACTGA
ATTTCTATTTCTATTTTACCTTAACTAATATTGTTTTAATGTTTCTATTTATTTTTAGAAGATGGTGGGTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNN
Blast Repeats showed best alignment with:
ZRSiTERTOOT0301 prem1_af391808-1 prem1_af391808-1 af391808 bases... 194 1e-49
ZRSiTERTOOT0294 prem1_276N13-4 prem1_276N13-4 276N13 bases 39168... 180 2e-45
Related Literature:
Chromosome Res. 1996 Jan;4(1):15-23.
Links
Molecular analysis of the structure of the maize B-chromosome.
Department of Botany, University of Reading, UK.
The overall composition of the maize B is similar to that of the standard chromosome complement (A-chromosomes). This has been demonstrated by the use of several methods including: (a) genomic in situ hybridization (GISH), (b) analysis of highly repetitive sequences by the comparison of restriction digests of 0B and +B DNA and (c) the characterization of middle-repetitive cloned sequences. By the use of the technique of random amplification of polymorphic DNA-polymerase chain reaction, we have identified a B-specific repetitive sequence family. Sequence analysis of the B-specific clone reveals a relationship to the PREM-1 family of maize retroelements, which are preferentially transcribed in pollen. These results suggest an internal origin of the B-chromosome from within the maize genome, but demonstrate also that specific sequences can evolve by rapid processes of genomic turnover. Models for the origin of the maize B are discussed in the context of the present data.
PMID: 8653263 [PubMed - indexed for MEDLINE]
